מהנדסה גנטית להנדסה גנומית: חלק שלישי – עריכה גנומית – CRISPR

dna-163466_1280-opqt305g0zxe9vlv89mcdtet78cj6hsxrpcirbk1i8

ב-2008 נכנסתי לתחום העריכה הגנומית. באותו זמן עבדתי עם אנזימים (ZFN) אותם היה עלי לבנות שוב ושוב כנגד כל אתר גנומי אותו רציתי לבחון. אחוזי ההצלחה היו נמוכים מאוד והחלום שלי היה לבנות אנזים יחיד שבאמת עובד ואפשר יהיה לתכנת אותו לחתוך מטרות גנומיות לפי בקשתך. כאן ראוי לציין כי יחד עם חברי, יואל שיבולת, הקמנו חברה (טארגטג'ן), העוסקת בתחום, והצלחנו לעמוד במשימה. אולם, החלק הנוכחי אינו עוסק בטכנולוגיה אותה אנו מפתחים אלא בטכנולוגיית ה-CRISPR שמשמעותה: clustered regularly interspaced short palindromic repeats.

זוהי למעשה מערכת הגנה שחיידקים פיתחו בכדי להתגונן מוירוסים (בקטרופאג'ים). מערכת ה-CRISPR בנויה כך שחלק זעיר מהגנום של הוירוס ניכנס לגנום החיידקי. כניסה זו היא לאתר ספציפי והתוצאה היא ייצור מקטע RNA קצר שחלקו זהה למקטע מהוירוס וחלקו מתחבר לרצף RNA אחר המתחבר לחלבוני מערכת ה-CRISPR. לכל חיידק מערכת CRISPR  שונה.

ב-2012 פרסמה ג'ניפר דודנה חלבון CRISPR בשם Cas9 שמסוגל גם להתחבר ל-RNA וגם לחתוך את ה-DNA הגנומי לפי ה-RNA אליו החלבון התחבר (https://www.youtube.com/watch?v=TdBAHexVYzc). למעשה, יש כאן נוקלאז בודד שניתן לתכנות ע"י RNA. תכונה זו ופשטות התיכנות גרמו לתחום ההנדסה הגנומי לפרוץ כמעט לכל תחומי המחקר.

Cas9 ותפקודו מוצגים בתמונה:

החלבון מתחבר ל-RNA שמכוון אותו למטרה, ועל כן נקרא guidRNA. החלבון פותח את ה-DNA ומאפשר קישור של ה-RNA ל-DNA. קישור זה חייב להיות על סמך התאמה ברצף וכך מושגת ספציפיות. לאחר קישור ה-RNA ל-DNA חלבון ה- Cas9 חותך את ה-DNA בשני מקומות (ע"י שני אתרי נוקלאז שונים) וכך גורם לשבר בגנום.

נחזור לרגע אל החיידק. אם ה-Cas9 יחתוך כל רצף גנומי שמתאים ל-RNA הרי שבראש ובראשונה הוא יחתוך את הרצף שמקודד ל-RNA ונמצא בחיידק עצמו, ללא קשר אם יש וירוס או לא. בכדי להימנע מבעיה זו, קיים רצף נוסף שקיים רק בוירוס ולא קיים בחיידק. רצף זה נקרא PAM. בכדי לחתוך אתר בגנום האנושי ולרפא מחלות, צריך לאתר רצף PAM ולתת RNA משלים לרצף שליד ה-PAM. לדוגמא: ה-PAM של Cas9הוא NGG.

הרצף אותו אני רוצה לחתוך הנו: ATGGTCACTGACACGTACACTACCGAATAGGAA

הרצף AGG ישמש כ-PAM ומכאן שרצף ה-RNA יכלול TGACACGTACACTACCGAAT (בהבדל ש-T הופך ל-U כשעוברים מ-DNA ל-RNA). אל הרצף הנ"ל נוסיף רצף RNA שניקשר ל-Cas9 וכך נקבל חיתוך של אתר המטרה שהוא שלושה נוקלאוטידים מאתר ה-PAM (ATGGTCACTGACACGTACACTACCG*AATAGGAA).

ה-Cas9 עובד ניפלא, הוא יעיל, נוח לעבודה ומזהה בקלות את האתר אותו עליו לחתוך לא רק בחיידקים שם נוצר אלא גם בתאים אנושיים, חרקים וצמחים. אם כך, מדוע עריכה גנומית ע"י Cas9 לא אושרה לריפוי מחלות בבני אדם? מדוע ג'ניפר דודנה ומדענים אחרים טוענים כי השיטה עדיין לא בטוחה לשימוש?

שתי סיבות, הראשונה: עוד לא עבר מספיק זמן. השניה והיא דרמתית יותר: ה-Cas9 זקוק להיכרות של 20 נוקלאוטידים בלבד בכדי לחתוך את אתר המטרה. אם ניקח רצף אקראי של 20 נוקלאוטידים ונחפש אותו בגנום אנושי (6 מיליארד נוקלאוטידים) נמצא אותו לפחות 3 פעמים, אם נצרף לכך את העובדה שיש לא מעט רצפים חוזרניים ואת העובדה שיש גמישות מסויימת בהיכרות נגיע למאות רצפים שאינם אתר המטרה שלנו אותם ה-Cas9 יחתוך. זוהי למעשה הבעיה העיקרית של שימוש ב-Cas9 לצורך עריכה גנומית. אני יכול להציל אדם ממחלה אחת ולגרום למחלה אחרת פשוט כי האנזים חתך את הגן הלא נכון.

 

מקורות:

https://www.nature.com/articles/d41586-019-00726-5

https://www.nytimes.com/2015/03/20/science/biologists-call-for-halt-to-gene-editing-technique-in-humans.html?_r=0?

 

עודד רהב – הדג מקפריסין

עודד רהב הוא יזם סדרתי, פעיל סביבתי, מחולל שינוי, או באנגלית- גנרטור. אחד מששת השחיינים ששחו מקפריסין לישראל במשחה שליחים ושברו שיא עולם, ומאז מצא בשחייה למרחקים

קרא עוד »
סגירת תפריט
×
×

עגלת קניות